View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_low_48 (Length: 251)
Name: NF5629_low_48
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 8e-36; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 14 - 124
Target Start/End: Original strand, 36706005 - 36706117
Alignment:
| Q |
14 |
aggtggcttgtctgctttcttaccggaccgccatgttgggatcctctgca-gctcaagatgtagccatcctcggttgtaacctaagttagcac-aaaaac |
111 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
36706005 |
aggtggcttgtccgctttcttatcggaccgccctgttgggatcctctgcaggctcaagatgtagccatcctcagttgtaacctgagttagcacaaaaaac |
36706104 |
T |
 |
| Q |
112 |
attgatggcaacc |
124 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36706105 |
attgatggcaacc |
36706117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 36706217 - 36706270
Alignment:
| Q |
198 |
gaggttgcaaaatggcatgtggaatgcaacatgctatagtaaatattatttacc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36706217 |
gaggttgcaaaatggcatgtggaatgcaacatgctatagtaaatattatttacc |
36706270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 18 - 108
Target Start/End: Original strand, 36713674 - 36713765
Alignment:
| Q |
18 |
ggcttgtctgctttcttaccggaccgccatgttgggatcctctgcag-ctcaagatgtagccatcctcggttgtaacctaagttagcacaaa |
108 |
Q |
| |
|
|||||||| |||||||||||||||| || | |||||||||||||| ||||||||||||||||| || |||||||||| ||| | |||||| |
|
|
| T |
36713674 |
ggcttgtccgctttcttaccggacctccctaccgggatcctctgcaggctcaagatgtagccatcatctgttgtaacctgagtcaacacaaa |
36713765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 99
Target Start/End: Complemental strand, 30903934 - 30903898
Alignment:
| Q |
63 |
agctcaagatgtagccatcctcggttgtaacctaagt |
99 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
30903934 |
agcttaagatgtagccatcctctgttgtaacctaagt |
30903898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University