View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_low_59 (Length: 238)
Name: NF5629_low_59
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 38483397 - 38483176
Alignment:
| Q |
1 |
tacagaatctcacgacgatgatcagagttattatttttaagatcaggaagcgagacacttgacttaacatgcaagtaactgcaccagtaagtgtaattac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38483397 |
tacagaatctcacgacgatgatcagagttattatttttaagatcaggaagcgagacacttgacttaacatgcaagtaactgcaccaggaagtgtaattac |
38483298 |
T |
|
| Q |
101 |
gtagaagattcttccggaacgagcggattacagaggcatcgagggaatcgatgttgtctggaggaggattgagacgcatctgagcattggcgagatggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483297 |
gtagaagattcttccggaacgagcggattacagaggcatcgagggaatcgatgttgtctggaggaggattgagacgcatctgagcattggcgagatggag |
38483198 |
T |
|
| Q |
201 |
gaggacatgttcccgttggttg |
222 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
38483197 |
gaggacatgttctcgttggttg |
38483176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 194
Target Start/End: Complemental strand, 30117655 - 30117591
Alignment:
| Q |
130 |
acagaggcatcgagggaatcgatgttgtctggaggaggattgagacgcatctgagcattggcgag |
194 |
Q |
| |
|
|||| ||| ||||| | ||||||||| || || || ||| ||||||||||||||||||||||||| |
|
|
| T |
30117655 |
acagcggcgtcgagagtatcgatgttatccggcggcggagtgagacgcatctgagcattggcgag |
30117591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University