View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_low_62 (Length: 234)
Name: NF5629_low_62
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 17277540 - 17277339
Alignment:
| Q |
16 |
tattctcatttataattcttggattggatgactaaaatgcaccactaccatagtgtacaatgaaggtgcttttggacaaaagtacattagatgctcttgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17277540 |
tattctcatttataattcttggattggatgactaaaatgcaccactaacatagtgtacaatgaaggtgcttttggacaaaagtacattagatgctcttgt |
17277441 |
T |
 |
| Q |
116 |
aaagcttgattttgatatatggttgaacaaatgtgacaacatgaagaattgagattattatgaatggttggaagaagaagctagctacaagacaaaaatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17277440 |
aaagcttgattttgatatatggttgaacaaatgtgacaacatgaagaattgagattattatgaatggttggaagaagaagctagctacaagacaaaaatt |
17277341 |
T |
 |
| Q |
216 |
tg |
217 |
Q |
| |
|
|| |
|
|
| T |
17277340 |
tg |
17277339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University