View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_low_63 (Length: 233)
Name: NF5629_low_63
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_low_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 93 - 225
Target Start/End: Original strand, 5288592 - 5288724
Alignment:
| Q |
93 |
gtgtatggtattatggaatattttcagttagaaaaggcaactgaaatctttattgaaattttaaatgaatcaaagatcttccccactccagaaattgaag |
192 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5288592 |
gtgtatggtataatggaatattttctgttagaaaaggcaactgaaatctttattgaaattttaaatgaatcaaagatctttcccactccagaaattgaag |
5288691 |
T |
 |
| Q |
193 |
ttctttcaacaataaaggttagcacagtataat |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5288692 |
ttctttcaacaataaaggttagcacagtataat |
5288724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 5288516 - 5288563
Alignment:
| Q |
28 |
gaattcagataggcagagttaataagagaggaaatggcaagtagtata |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5288516 |
gaattcagataggcagagttaataagagaggaaatggcaagtagtata |
5288563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University