View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5629_low_65 (Length: 231)

Name: NF5629_low_65
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5629_low_65
NF5629_low_65
[»] chr4 (1 HSPs)
chr4 (1-214)||(45540595-45540808)


Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 45540595 - 45540808
Alignment:
1 aaataacagtgactccgatgatgtagttaaatcatggcaaacccagccatctccatgtgatattgtatcaacaaatgttgaatcacatcacccctttaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45540595 aaataacagtgactccgatgatgtagttaaatcatggcaaacccagccatctccatgtgatattgtatcaacaaatgttgaatcacatcacccctttaaa 45540694  T
101 gaaattgagaaaggacaacagggagtggatgatactatccatacggggacatcatcttttccaactttagaaccattaaaccaagaacaaacgtgcgctt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
45540695 gaaattgagaaaggacaacagggagtggatgatactatccatacagggacatcatcttttccaactttagaatcattaaaccaagaacaaacgtgcgctt 45540794  T
201 ctataaatgtcaca 214  Q
    ||||||||||||||    
45540795 ctataaatgtcaca 45540808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University