View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_low_66 (Length: 229)
Name: NF5629_low_66
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 208
Target Start/End: Original strand, 48672235 - 48672432
Alignment:
| Q |
11 |
gagtgagatgaacatggaagcttctagaatgacgctgcaccgattcggcaacacttctagtagcagcatttggtatgagcttgcttatatggaagctaag |
110 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48672235 |
gagtgacaagaacatggaagcttctagaatgacgctgcaccgattcggcaacacttctagtagcagcatttggtatgagcttgcttatatggaagctaag |
48672334 |
T |
 |
| Q |
111 |
gaaaaagttaaaagaggagaccgtgtttggcaacttgcttttggttctggttttaagtgtaacagtgctgtttggcgttcgatgcgtcgtgttacaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48672335 |
gaaaaagttaaaagaggagaccgtgtttggcaacttgcttttggttctggttttaagtgtaacagtgctgtttggcgttcgatgcgtcgtgttacaaa |
48672432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 15239657 - 15239705
Alignment:
| Q |
137 |
ttggcaacttgcttttggttctggttttaagtgtaacagtgctgtttgg |
185 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15239657 |
ttggcaaattgcatttggttctggttttaagtgtaatagtgctgtttgg |
15239705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 137 - 188
Target Start/End: Original strand, 34053356 - 34053407
Alignment:
| Q |
137 |
ttggcaacttgcttttggttctggttttaagtgtaacagtgctgtttggcgt |
188 |
Q |
| |
|
||||||| |||| ||||||||||| ||||| |||||||||||||| |||||| |
|
|
| T |
34053356 |
ttggcaaattgcatttggttctggatttaaatgtaacagtgctgtgtggcgt |
34053407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 136 - 185
Target Start/End: Complemental strand, 19742853 - 19742804
Alignment:
| Q |
136 |
tttggcaacttgcttttggttctggttttaagtgtaacagtgctgtttgg |
185 |
Q |
| |
|
|||||||| |||| ||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
19742853 |
tttggcaaattgcatttgggtctggatttaagtgtaacactgctgtttgg |
19742804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 136 - 185
Target Start/End: Original strand, 19797235 - 19797284
Alignment:
| Q |
136 |
tttggcaacttgcttttggttctggttttaagtgtaacagtgctgtttgg |
185 |
Q |
| |
|
|||||||| |||| ||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
19797235 |
tttggcaaattgcatttgggtctggatttaagtgtaacactgctgtttgg |
19797284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University