View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5630-Insertion-5 (Length: 522)
Name: NF5630-Insertion-5
Description: NF5630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5630-Insertion-5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 2e-50; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 281 - 414
Target Start/End: Complemental strand, 30917991 - 30917858
Alignment:
| Q |
281 |
aattaatggtttggaaataaactctatattttaattgattttatttaatttaaatttgtaccttgctttacaccttaagaaaactataacagtgttggcc |
380 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
30917991 |
aattaaaggtttggaaataaactctatattttaattgattttatttaatttaaatttgtaccttgctttgcatcttaagaaaactataacagtgttggct |
30917892 |
T |
|
| Q |
381 |
tggattatatatgtgaaaaaccattttttcatga |
414 |
Q |
| |
|
|| |||||| |||| |||||||||||||||||| |
|
|
| T |
30917891 |
tgcattatacatgttgaaaaccattttttcatga |
30917858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 110 - 179
Target Start/End: Complemental strand, 30918176 - 30918107
Alignment:
| Q |
110 |
aaatatttgatcagacaacttttaaagaagtttgattgccataaactatggattgggaaaatatcttagg |
179 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30918176 |
aaatatttgatcagacaacgtttaaagaagtttgattgccataaactatggattgggaaaatatcttagg |
30918107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 222 - 282
Target Start/End: Complemental strand, 30918107 - 30918050
Alignment:
| Q |
222 |
gatatatgttatattcatgaatagagttctgagctaatgttgtgtcaaaaatcactagcaa |
282 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
30918107 |
gatatatgttatattcatggatagagttgtgagctaatgttgtgt---aaatcactagcaa |
30918050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 492 - 522
Target Start/End: Complemental strand, 30917759 - 30917729
Alignment:
| Q |
492 |
tttgtttttcatattttcatatctttatcat |
522 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30917759 |
tttgtttttcatattttcatatctttatcat |
30917729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University