View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5630_high_10 (Length: 257)
Name: NF5630_high_10
Description: NF5630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5630_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 2095025 - 2095073
Alignment:
| Q |
18 |
gtggtggacctttgaagatcaaaatatagccaaatgggcaaacagaggt |
66 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
2095025 |
gtggtggacctttgaagatcaagatatagccaaatgggcacaccgaggt |
2095073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 209 - 238
Target Start/End: Complemental strand, 36789479 - 36789450
Alignment:
| Q |
209 |
ttgtattgtcacgtgtcacatttaaattga |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36789479 |
ttgtattgtcacgtgtcacatttaaattga |
36789450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University