View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5630_high_11 (Length: 254)
Name: NF5630_high_11
Description: NF5630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5630_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 44849083 - 44848849
Alignment:
| Q |
1 |
cgatagaaagaaacattgtgatacctctgctctggcaatacttgatgccgtgacttaatttggtgcatgaattagttgaagggttgcagtgacctgctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44849083 |
cgatagaaagaaacattgtgatacctctgctctggcaatacttgatgctgtgacttaatttggtgcatgaattagttgaagggttgcagtgacctgctaa |
44848984 |
T |
|
| Q |
101 |
gttcaacgtaggggttcgaccattgccgaatctggagaggaaggcaatgtttatgtgggtgtatctcccagtggcacatgtttcatacagtgagccttct |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44848983 |
gttcaacgtaggggttcgacctttgccgaatctggagaggaaggcaatgtttatgtgggtgtatctcccagtggcacatgtttcatacagtgagccttct |
44848884 |
T |
|
| Q |
201 |
tcaccattttggccccagtagatggctatgccacc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44848883 |
tcaccattttggccccagtagatggctatgccacc |
44848849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University