View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5630_low_4 (Length: 356)
Name: NF5630_low_4
Description: NF5630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5630_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 133 - 277
Target Start/End: Original strand, 36265754 - 36265898
Alignment:
| Q |
133 |
aagataactattaattttactcttctatatatagttgaaaattgagttaaatcaactttaaagaaagtcgtaaatcaatttatagtaacatttgattagt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36265754 |
aagataactattaattttactcttctatatatagtttaaaattgagttaaatcaactttaaagaaagtcgtaaatcaatttatactaacatttgattagt |
36265853 |
T |
|
| Q |
233 |
tttttggttttattttcacaattcctattaatctcttcacttaaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36265854 |
tttttggttttattttcacaattcctattaatctcttcacttaaa |
36265898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 307 - 340
Target Start/End: Original strand, 36265895 - 36265928
Alignment:
| Q |
307 |
taaacacgaatctttgtaccctcatgtatttaac |
340 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
36265895 |
taaacacaaatctttgtaccctcatgtatttaac |
36265928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University