View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5630_low_6 (Length: 336)
Name: NF5630_low_6
Description: NF5630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5630_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 129 - 281
Target Start/End: Complemental strand, 53422047 - 53421895
Alignment:
| Q |
129 |
gttgtttgtttgcaaaagtattattattgtagtaattataggctaggatgcactctgaacaacacattatccccagaattagtatcaaaatccataaaac |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||| |
|
|
| T |
53422047 |
gttgtttgtttgcaaaagtattattattgtagtaattataggctaggatgcactctgaacaacacgttagccccagaattagtatcaaaattcataaaac |
53421948 |
T |
 |
| Q |
229 |
atcatagtaatccagaatgcgttgaatacaatgtgaacaaacacctactgagt |
281 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53421947 |
atcataataatccagaatgcgttgaatacaatgtgaacaaatacctactgagt |
53421895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 12 - 90
Target Start/End: Complemental strand, 53422483 - 53422393
Alignment:
| Q |
12 |
aagaaacgataaataaatacaagttgagctctt------------ttatgcccttttgagtaaaaattgttatatgcccggcataaaattt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53422483 |
aagaaacgataaataaatacaagttgagctcttgtactttatgttttatgcccttttgagtaaaaattgttatatgctcggcataaaattt |
53422393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University