View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5630_low_9 (Length: 277)
Name: NF5630_low_9
Description: NF5630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5630_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 135 - 260
Target Start/End: Complemental strand, 28325396 - 28325271
Alignment:
| Q |
135 |
cagcaacgtgtcggttaataggaggcgatggaattgggtgaatcacacccaactgagttctaagcttatccacaattggatcctcttgaaaagtagtaaa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28325396 |
cagcaacgtgtcggttaataggaggcgatggaatcgggtgaatcacacccaactgagttctaagcttatccacaattggatcctcttgaaaagtagtaaa |
28325297 |
T |
 |
| Q |
235 |
atttgaacccaattgaacctgcgaat |
260 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28325296 |
atttgaacccaattgaacctgcgaat |
28325271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 28325530 - 28325436
Alignment:
| Q |
1 |
caacgaaaaactagtaggaacctgcggccacacaccgcgaaaactatcttcactactaactttgttcctccttcttctaaaagtccataatttat |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28325530 |
caacgaaaaactagtaggaacctgcggccacacaccgcgaaaactatcttcactactaactttgttcctccttcttctaaaagtccataatttat |
28325436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University