View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5632_low_1 (Length: 427)
Name: NF5632_low_1
Description: NF5632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5632_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 9 - 261
Target Start/End: Original strand, 4607839 - 4608087
Alignment:
| Q |
9 |
gaagaaaatatactcaaatgggtttttgaaatgaaactatactcaatgagttttttgaactagaagaaaactctttctaactagctagctcacgggtttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4607839 |
gaagaaaatatactcaaatgggtttttgaaatgaaactatactcaatgagttttttgaactagaagaaaactctttctaactag----ctcacgggtttc |
4607934 |
T |
|
| Q |
109 |
tttgttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgacagtgattttttagattg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4607935 |
tttgttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgccagtgattttttagattg |
4608034 |
T |
|
| Q |
209 |
ttattgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608035 |
ttattgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa |
4608087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 325 - 415
Target Start/End: Original strand, 4608236 - 4608326
Alignment:
| Q |
325 |
tgttttgtctctaattcttgtctcttcaatatgaaggtgttttagattttgaagttttatgcaagtaatattctaatgggttttgattgat |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608236 |
tgttttgtctctaattcttgtctcttcaatatgaaggtgttttagattttgaagttttatgcaagtaatattctaatgggttttgattgat |
4608326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 306 - 377
Target Start/End: Original strand, 4608132 - 4608203
Alignment:
| Q |
306 |
cctatgattaatgttattatgttttgtctctaattcttgtctcttcaatatgaaggtgttttagattttgaa |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
4608132 |
cctatgattaatgttattatgttttgtctctaattcttgtctctttaccatgtaggtgttttagattttgaa |
4608203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University