View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5633-Insertion-2 (Length: 452)
Name: NF5633-Insertion-2
Description: NF5633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5633-Insertion-2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 408; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 8 - 431
Target Start/End: Original strand, 40358657 - 40359080
Alignment:
| Q |
8 |
caaagaaccttaccttagcaagcttctcgaacgtgttggcgcgccgaggagtccagtctcggattgcatcaccagcaacttccatcaaccacggcggcca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40358657 |
caaagaaccttaccttagcaagcttctcgaacgtgttggcgcgccgaggagtccagtctcggattgcatcaccagcaacttccatcaaccacggcggcca |
40358756 |
T |
|
| Q |
108 |
actctgttgagttgctgccaatgaattaagtcgaggtagcaggctcaccggtgccggaagttcaccggcggtaggagcctcagtctcctgcttctcccga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| || |
|
|
| T |
40358757 |
actctgttgagttgctgccaatgaattaagtcgaggtagcaggctcaccggtgccggaagttcacaggcggtaggagcctcagcctcctgcttctcctga |
40358856 |
T |
|
| Q |
208 |
acttcaacagcattattacctccgttagcagttgcagtgttatcacggcgacgatgccgagctccggcaccggcaggttttccgagcgcgcaacccatcc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40358857 |
acttcaacagcattattacctccgttagcagttgcagtgttatcacggcgacgatgccgagctccggcaccggcaggttttccgagcgcgcaacccatcc |
40358956 |
T |
|
| Q |
308 |
gtcaacggttggcggtggaagagtttggacaacgcatggagccgccgtaagtaagaggtgccggaaaataagcaaagattttatatttatttttaaggtg |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40358957 |
gtcaacggttggcggtggaagagtttggacaacgcatggagccgccgttagtaagaggtgccggaaaataagcaaagattttatatttatttttaaggtg |
40359056 |
T |
|
| Q |
408 |
agggaggagtttgaggttgtcact |
431 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40359057 |
agggaggagtttgaggttgtcact |
40359080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University