View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5633_high_29 (Length: 223)
Name: NF5633_high_29
Description: NF5633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5633_high_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 37547409 - 37547617
Alignment:
| Q |
16 |
aaagagacatttgatctcgtccaaatgatactagatgagatattttactgttttaggctttagcattgatacatatctttgataaattaaaa-cggtatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37547409 |
aaagagacatttgatctcgtccaaatgatactagatgagatattttactgttttaggctttagcattgatacatatctttgataaattaaaaacggtatt |
37547508 |
T |
 |
| Q |
115 |
tttcttaaattgaattacgtcagtttccttgaatatatattacgttaaaaacgattaacgaaaagcatcgagaagcaagataagcttagattggacgcag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37547509 |
tttcttaaattgaattacgtcagtttccttgaatatatattacgttaaaaacgattaacgaaaagcatcgagaagcaagataagattagattggacgcag |
37547608 |
T |
 |
| Q |
215 |
tcatagaac |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
37547609 |
tcatagaac |
37547617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University