View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5633_low_14 (Length: 353)
Name: NF5633_low_14
Description: NF5633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5633_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 238
Target Start/End: Original strand, 31363843 - 31364068
Alignment:
| Q |
15 |
actaaggaggatatata--caccaagaaacttgagctacacaaaaggtttcattgacaaagactatgcaagataggtctcgtgttttgtcttagacaaaa |
112 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31363843 |
actaaggaggatatatatccaccaagaaacttgagctacacaaaaggtttcattgacaaagactatgcaagataggtctcgtgttttgtcctagacaaaa |
31363942 |
T |
 |
| Q |
113 |
tggtcattgagatttaatttttggaaaatttgcatgtgtcctatggtccatttatttttggatgatctattcgattatatcgtatatttttcatttttgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31363943 |
tggtcattgagatttaatttttggaaaatttgcatgtgtcctatggtccatttctttttggatgatctattcgattatatcgtatatttttcatttttgt |
31364042 |
T |
 |
| Q |
213 |
aatagtttcaccgtagattgcatgca |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31364043 |
aatagtttcaccgtagattgcatgca |
31364068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 229 - 353
Target Start/End: Original strand, 31364339 - 31364464
Alignment:
| Q |
229 |
attgcatgcatggctatgtcctacgcaattcaggtatgagcactttcatgtttctagaaagcatattggccagcgaccagaattagttgtgctta-tact |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31364339 |
attgcatgcatggctatgtcctacgcaattcaggtatgaacactttcatgtttctagaaagcatattgggcagcgaccagaattagttgtgcttagtact |
31364438 |
T |
 |
| Q |
328 |
accatatgaattcatgtcctttcgac |
353 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31364439 |
accatatgaattcatgtcctttcgac |
31364464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University