View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5633_low_23 (Length: 250)
Name: NF5633_low_23
Description: NF5633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5633_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 21316379 - 21316584
Alignment:
| Q |
1 |
ccactgcaacaatgacaatgaatgtccaccaagtatttggaagccctttgcaaggtgcaaaatgaaccgatgtatatattctagaatgcagccaccttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21316379 |
ccactgcaacaatgacaatgaatgtccaccaagtacttggaagccctttgtaaggtgcaaaatgaaccgatgtatatattctagagtgcagccaccttgg |
21316478 |
T |
 |
| Q |
101 |
ggctgtcgagtacgagcccaaacagagtacaattacgccatacaaggaagaatagtcccttacgctagaaaaaactatgcaatatacattatactataat |
200 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
21316479 |
gcttgttgagtacgagcccaaacagagtacaattacgccatacaaggaagaatagtcccttacgctaggaaaaactatgcaatatacattttactataat |
21316578 |
T |
 |
| Q |
201 |
attcca |
206 |
Q |
| |
|
|||||| |
|
|
| T |
21316579 |
attcca |
21316584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 21319635 - 21319823
Alignment:
| Q |
17 |
aatgaatgtccaccaagtatttggaagccctttgcaaggtgcaaaatgaaccgatgtatatattctagaatgcagccaccttggggctgtcgagtacgag |
116 |
Q |
| |
|
||||| ||||||||| ||||| ||| ||||||| ||||||| || |||||||||||||||||||||| || | ||||||| || ||| ||||||||| |
|
|
| T |
21319635 |
aatgattgtccaccagatatttcgaatccctttgtaaggtgcgaatcgaaccgatgtatatattctagattggaaccaccttttggttgttgagtacgag |
21319734 |
T |
 |
| Q |
117 |
cccaaacagagtacaattacgccatacaaggaagaatagtcccttacgctagaaaaaactatgcaatatacattatactataatattcca |
206 |
Q |
| |
|
||| | ||||||||| ||||||||| || |||||||||| |||||| |||| ||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
21319735 |
ccctagcagagtacatttacgccatgcagagaagaatagt-ccttacactaggaaaaactatgcaatatacatttcactagaatattcca |
21319823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University