View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5633_low_25 (Length: 243)
Name: NF5633_low_25
Description: NF5633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5633_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 7785910 - 7786131
Alignment:
| Q |
6 |
ccgagttttgagcatcttgatctcgactggctgctttctctggttgattcatgttgatagtcaagacttttgagcgggaagttcgtattttagatttgnn |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
7785910 |
ccgagttttgagcatcttgatctcgactggctgctttctctggttgattcatgttgatagtcaagacttttgagcgggaagctcgtattctagatttgtt |
7786009 |
T |
 |
| Q |
106 |
nnnnnaggcaaaatctgcatccgtattgactcttgacccaatgcccaccaatgtgttgagggcgtcaatgcaaagattgttggctgaaggcaatctgaat |
205 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7786010 |
tttttaggcaaaatctgcatctgtcttgactcttgacccaatgcccaccaatgtgttgagggcgtcaatgcaaagattgttggctgaaggcaatctgaat |
7786109 |
T |
 |
| Q |
206 |
tccctggaccacccaataaaat |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7786110 |
tccctggaccacccaataaaat |
7786131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University