View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5633_low_26 (Length: 240)
Name: NF5633_low_26
Description: NF5633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5633_low_26 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 6681397 - 6681166
Alignment:
| Q |
19 |
cttcggtttctggattgatatttttgacaagcaaaggctgggtcaagactggatataaaaaacattctatccttgatgctctcaacttttttcaacatca |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6681397 |
cttcggtttctggattgatatttt-gacaagcaaaggctgggtcaagactggatataaaaaacattctatccttgatgctctcaacttttttcaacatca |
6681299 |
T |
 |
| Q |
119 |
atgttgaaaaattgtaaacaaaaactgcagtaaccttatcttgtgaatggaaaatttgtattagaaacagtacattgtt-----------ggatccttac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | | |||||| |
|
|
| T |
6681298 |
atgttgaaaaattgtaaacaaaaactgcagtaaacttatcttgtgaatggaaaatttgtattagaaacagtacattgttaatatgtattagtaaccttac |
6681199 |
T |
 |
| Q |
208 |
aagtgagtggtatattgctcaaagcttggagtt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6681198 |
aagtgagtggtatattgctcaaagcttggagtt |
6681166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 213
Target Start/End: Complemental strand, 6675955 - 6675871
Alignment:
| Q |
130 |
ttgtaaacaaaaactgcagtaa-ccttatcttgtgaatggaaaatttgtattagaaacagtacattgttggatccttacaagtga |
213 |
Q |
| |
|
||||||||| |||||||||||| || ||||| | ||| |||||||| |||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
6675955 |
ttgtaaacataaactgcagtaaacccaatcttataaatagaaaatttctattcgaaatagtacattgttggatcctatcaagtga |
6675871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University