View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5633_low_27 (Length: 238)
Name: NF5633_low_27
Description: NF5633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5633_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 31364494 - 31364718
Alignment:
| Q |
1 |
ctcagccaatatttgaggaatacagtattatgacgtcacatttacaaataatttgttggagggagattaannnnnnnaagcaaaaaattattactaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31364494 |
ctcagccaatatttgaggaatacagtattatgacgtcacatttacatataatttgttggagggagattaatttttttaagcaaaaaattattactaaaaa |
31364593 |
T |
 |
| Q |
101 |
cgataacacttnnnnnnnnn----gattattgttatcacatgtgcatacattatgctcttcaatatatttcatttatcttgaaatcacttttttctcaat |
196 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31364594 |
cgataacactaaaaaaaaagaaaagattattgttatcacatgtgcatacattatgctcttcaatatatttcatttatcttgaaatcactttttgctcaat |
31364693 |
T |
 |
| Q |
197 |
tagttattacatttgttgtaatttt |
221 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
31364694 |
tagttattacattagttgtaatttt |
31364718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University