View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5633_low_8 (Length: 454)
Name: NF5633_low_8
Description: NF5633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5633_low_8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 401; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 401; E-Value: 0
Query Start/End: Original strand, 35 - 454
Target Start/End: Complemental strand, 30296085 - 30295668
Alignment:
| Q |
35 |
gttgcttaaaacagtgatctgagaatgtattctttatccatatcttatactagctattggcaaattaaaaatatatctatcttatagctttcaccgtcac |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30296085 |
gttgcttaaaacagtgatctgagaatgtattctttatccatatcttatactagctattggcaaaataaaaatatatctatcttatagctttcaccgtcac |
30295986 |
T |
|
| Q |
135 |
gatataagtgtgaagagaatgattgatatgaacgatcttattgctttggccggctgtgtcatctttatgttttactaatttcttctatcaatacaaaatc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30295985 |
gatataagtgtgaagagaatgattgatatgaacgatcttattgctttggccggctgtgtcatctttatgttttactaatttcttctatcaatacaaaatc |
30295886 |
T |
|
| Q |
235 |
attgtcacatttctctctcacacacacagtttatggctgatgatgctgattatcaacctttgttcgataccaaatttggtgtgatactaattgccatggg |
334 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30295885 |
attgtcacatttctctctcaca--cacagtttatggctgatgatgctgattatcaacctttgttcgataccaaatttggtgtgatactaattgccatggg |
30295788 |
T |
|
| Q |
335 |
ttcagctagctttgtggttacaatataccatctcatattcatttgctgcaaacacgcatccgaacaagcgcggcagcatgagcaaccagcaacacaaacg |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30295787 |
ttcagctagctttgtggttacaatataccatctcatattcatttgctgcaaacacgcatccgaacaagcgcggcagcatgagcaaccagcaacacaaacg |
30295688 |
T |
|
| Q |
435 |
ccgagcacggaagaaggaag |
454 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
30295687 |
ctgagcacggaagaaggaag |
30295668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University