View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5634-Insertion-1 (Length: 299)
Name: NF5634-Insertion-1
Description: NF5634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5634-Insertion-1 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 8 - 299
Target Start/End: Original strand, 33187060 - 33187363
Alignment:
| Q |
8 |
aaagctaattcagaatctgattcaaaggttttgaccggtgattcgttgccggcggtgattact---a---ctgctgctgctgctactactcctcaatcaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
33187060 |
aaagctaattcagaatctgattcaaaggttttgaccggtgattcgttgccggcggtgattactactactgctgctgctgctgctactactcctcaatcaa |
33187159 |
T |
|
| Q |
102 |
atagtggtgtgtcctctgctttggagactcagaagctaggtaga----tatttatttatttatttgtg-aaacatgnnnnnnngtgcaatttttgttttc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
33187160 |
atagtggtgtgtcctctgctttggagactcagaagctaggtagatatttatttatttatttatttgtgaaaacatgaaaaaaagtgcaatttttgttttc |
33187259 |
T |
|
| Q |
197 |
tgggttg-nnnnnnnnnnnnnnnnnnngtcatgtttgatgtggttaaaatttgatactaactaattcaaaattttgtttttggtgttattgtttgtttat |
295 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33187260 |
ggggttgtttttttgttttgtttttttgtcatgtttgatgtggttaaaatttgatactaacaaattcaaaattttgtttttggtgttattgtttgtttat |
33187359 |
T |
|
| Q |
296 |
gtgg |
299 |
Q |
| |
|
|||| |
|
|
| T |
33187360 |
gtgg |
33187363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University