View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5634_high_9 (Length: 229)
Name: NF5634_high_9
Description: NF5634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5634_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 17114491 - 17114384
Alignment:
| Q |
8 |
atacatcgattcatatcctcactcttgattccaatttaatcagttttgttaattcctttatattagatctgcaatgttgcgaacttctcttccaacatta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17114491 |
atacatcgattcatatcctcactcttgattccaatttaatcagttttgttaattcctttatattagatctgcaatgttgcgaacttctcttccaacatta |
17114392 |
T |
 |
| Q |
108 |
ttgtgttc |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
17114391 |
ttgtgttc |
17114384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 116 - 229
Target Start/End: Complemental strand, 17114343 - 17114229
Alignment:
| Q |
116 |
ggcttattccatgcataaacatataaaatataaaacttattgactcttattccaaattcaactttcgatacccaaataacaatgtgacaaaagtgcagat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17114343 |
ggcttattccatgcataaacatataaaatataaaacttattgactcttattccaaattcaactttcgataaccaaataacaatgtgacaaaagtgcagat |
17114244 |
T |
 |
| Q |
216 |
-aaatttgtagcatt |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17114243 |
aaaatttgtagcatt |
17114229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University