View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5635_high_3 (Length: 246)
Name: NF5635_high_3
Description: NF5635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5635_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 414324 - 414546
Alignment:
| Q |
19 |
aaatctcactttcttctcttttct------tccgccgcaaccatgtcatccaccaccgcaaccaacgccgtctccgccacagatgatgcgaaacacggtt |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
414324 |
aaatctcactttcttctcttttcttcttcttccgccgcaaccatgtcatccaccaccgcaaccgacgccgtctccgccacagatgatgcgaaacacggtt |
414423 |
T |
 |
| Q |
113 |
tctctcgtcctgagatgtacaaagaaaacctcgctggaaccgtagcttcttacgatcgtcacgtttttctctgttacaagaatcgtcaaacttggcctcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414424 |
tctctcgtcctgagatgtacaaagaaaacctcgctggaaccgtagcttcttacgatcgtcacgtttttctctgttacaagaatcgtcaaacttggcctcc |
414523 |
T |
 |
| Q |
213 |
gcgtcttgaagcttctgatgatg |
235 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
414524 |
gcgtcttgaagcttctgatgatg |
414546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 110 - 233
Target Start/End: Complemental strand, 401202 - 401079
Alignment:
| Q |
110 |
gtttctctcgtcctgagatgtacaaagaaaacctcgctggaaccgtagcttcttacgatcgtcacgtttttctctgttacaagaatcgtcaaacttggcc |
209 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||| |||||||| || | || ||||||||||| || ||||| ||||||||||| | ||||||||||| |
|
|
| T |
401202 |
gtttctcccgttatgagatgtacaagcaaaaccttgctggaacagttgaatcctacgatcgtcatgtctttctatgttacaagaaccaccaaacttggcc |
401103 |
T |
 |
| Q |
210 |
tccgcgtcttgaagcttctgatga |
233 |
Q |
| |
|
|||| || ||||||| || ||||| |
|
|
| T |
401102 |
tccgtgtgttgaagcctccgatga |
401079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University