View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5636-Insertion-6 (Length: 95)
Name: NF5636-Insertion-6
Description: NF5636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5636-Insertion-6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 8 - 95
Target Start/End: Complemental strand, 115397 - 115309
Alignment:
| Q |
8 |
gttggagcataactgagttt-gaatttgggtttttactgaatcaacatcgattggtttcttcaaccctatgacacagtggattatttgg |
95 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
115397 |
gttggagcataactgagttttggatttgggtttttactgaatcaacatcgattggtttcttcaaccctatgacacagtggattatttgg |
115309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 3e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 3e-17
Query Start/End: Original strand, 8 - 95
Target Start/End: Complemental strand, 14832445 - 14832357
Alignment:
| Q |
8 |
gttggagcataactgagtt-tgaatttgggtttttactgaatcaacatcgattggtttcttcaaccctatgacacagtggattatttgg |
95 |
Q |
| |
|
||||||||||||| ||||| || |||||| | |||||||| |||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
14832445 |
gttggagcataacagagttctggatttggttatttactgagtcaacatcaattggattcttcagacctatgacacagtggattatttgg |
14832357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University