View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5636_high_11 (Length: 280)
Name: NF5636_high_11
Description: NF5636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5636_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 52763636 - 52763360
Alignment:
| Q |
1 |
ttgtataacttgctataggatctagtcgtcatcgtcaatggtcttcaatatcaacatgcaaagtaacagcctccaccgccacttttatgccttcatannn |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763636 |
ttgtataacttgctataggatctagttgtcatcgtcaatggtcttcaatatcaacatgcaaagtaacagcctccaccgccacttttatgccttcataacc |
52763537 |
T |
|
| Q |
101 |
nnnnnnnnnnnnnnnnnnnnnntaaagaaaacatctccgccgccaaaatccaacgattttcagccaactcaaacaactgcttaaacctatctctaagagg |
200 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52763536 |
ccacccccacccccacccaccctaaataaaacatctccgccgctaaaatccaacgattttcagccaattcaaacaactgcttaaacctatctctaagagg |
52763437 |
T |
|
| Q |
201 |
aatactaactaataaaggatttgttcatacaaatgttttgagtccattaccaactacccttttttaatattcttcga |
277 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52763436 |
aatactacctaataaaggatttgttcatacagatgatttgagtccattaccaactacccttttttaattttcttcga |
52763360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University