View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5636_high_23 (Length: 209)
Name: NF5636_high_23
Description: NF5636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5636_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 6163139 - 6162935
Alignment:
| Q |
1 |
cgtgggtgtaagagaataatctagaaacttgatggtcccccagaatatatactatataagcaatgcaaacaccaaattaaattaatcacgtgaagcatat |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6163139 |
cgtgggtgtaaaagaataatctagaaacttgatggtcccccagaatatatactgtag--gcaatgtaaacaccaaattaaattaatcacgtgaagcatat |
6163042 |
T |
 |
| Q |
101 |
gcttcattatggaaatgtgatggaatcacaattattcctgtgcaaaaccaagtaaagttaattctagtttaaagttgggagattctgaagagatatcact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6163041 |
gcttcattatggaaatgtgatggaatcataattattcctgtgcaaaaccaagtaaagttaattctagtttaaagttgggagattctgaagagatatcact |
6162942 |
T |
 |
| Q |
201 |
tgttgat |
207 |
Q |
| |
|
||||||| |
|
|
| T |
6162941 |
tgttgat |
6162935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University