View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5636_high_4 (Length: 407)

Name: NF5636_high_4
Description: NF5636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5636_high_4
NF5636_high_4
[»] chr7 (2 HSPs)
chr7 (73-149)||(40643450-40643526)
chr7 (22-69)||(40643334-40643381)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 73 - 149
Target Start/End: Original strand, 40643450 - 40643526
Alignment:
73 attgggatttgattcgttaagatttacttaagggttatatcatatttattttagattttaaattttatattccctta 149  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40643450 attgggatttgattcgttaagatttacttaagggttatatcatatttattttagattttaaattttatattccctta 40643526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 22 - 69
Target Start/End: Original strand, 40643334 - 40643381
Alignment:
22 gttaagctcttaggaaggttatggatgagcccccttcttctctgtaca 69  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
40643334 gttaagctcttaggaaggttatggatgagcccccttcttctctgtaca 40643381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University