View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5636_high_4 (Length: 407)
Name: NF5636_high_4
Description: NF5636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5636_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 73 - 149
Target Start/End: Original strand, 40643450 - 40643526
Alignment:
| Q |
73 |
attgggatttgattcgttaagatttacttaagggttatatcatatttattttagattttaaattttatattccctta |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40643450 |
attgggatttgattcgttaagatttacttaagggttatatcatatttattttagattttaaattttatattccctta |
40643526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 22 - 69
Target Start/End: Original strand, 40643334 - 40643381
Alignment:
| Q |
22 |
gttaagctcttaggaaggttatggatgagcccccttcttctctgtaca |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40643334 |
gttaagctcttaggaaggttatggatgagcccccttcttctctgtaca |
40643381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University