View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5636_low_18 (Length: 241)
Name: NF5636_low_18
Description: NF5636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5636_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 52763749 - 52763966
Alignment:
| Q |
1 |
tattcttcacaatcggattcctaaccaaggataatcttttcatacgaggcatcatttaccagaattcaaaactttgtgttagtggttgtggcaatattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763749 |
tattcttcacaatcggattcctaaccaaggataatcttttcatacgaggcatcatttaccagaattcaaaactttgtgttagtggttgtggcaatattgg |
52763848 |
T |
 |
| Q |
101 |
caaatcatattttcattggcttggta-tatcatcacataatctatttagtgtttctgatcactttgttcaatttggacaatcaacagaaaattttatgtg |
199 |
Q |
| |
|
||||||||||||||||| | ||| || | | || ||||||| ||||||| || ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52763849 |
caaatcatattttcattag-ttgttaccgttttgac----tctattttgtgtttcagaccactttgttcaatttggacaatcaacataaaattttatgtg |
52763943 |
T |
 |
| Q |
200 |
attctagtggttgtggcaatatc |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52763944 |
attctagtggttgtggcaatatc |
52763966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University