View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5637_high_12 (Length: 214)
Name: NF5637_high_12
Description: NF5637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5637_high_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 4998654 - 4998867
Alignment:
| Q |
1 |
agttgaatcagttcaatgtttctgataacaaattatccggtgaggttccttctggttttaaccacgaagtttatttgtcaggtctaatgggaaatccagg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4998654 |
agttgaatcagttcgatgtttctgataacaaattatccggtgaggttccttccggttttaaccacgaagtttatttgtcaggtctaatgggaaatccagg |
4998753 |
T |
|
| Q |
101 |
tttatgtagcaatgttatgaaaaccttaaatccttgttcaaaacaaagacggttttctgttgtggcaatagttgttttatctgctattcttgtgttgatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4998754 |
tttatgtagcaatgttatgaaaaccttaaatccttgttcaaaacacagacggttttctgttgtggcaatagttgttttatctgctattcttgtgttgatt |
4998853 |
T |
|
| Q |
201 |
tttctgtctgtttt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4998854 |
tttctgtctgtttt |
4998867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University