View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5637_low_13 (Length: 205)
Name: NF5637_low_13
Description: NF5637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5637_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 10 - 205
Target Start/End: Original strand, 35913836 - 35914031
Alignment:
| Q |
10 |
aagaatatacatgcagttgatcatttgtggtcaatactctagactagaagtgaactgtgaaagaaaacactatgagttcaacacaaagctatgaggtcaa |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35913836 |
aagaaaatacatgcagttgatcatttgtggtcaatgctctagactagaagtcaactttgaaagaaaacactatgagttcaacacaaagctatgaggtcaa |
35913935 |
T |
 |
| Q |
110 |
cattagtcaaagctatgtggactcaaatcataatttgtggtaagatataaagacaaagctttgtgggttcaaaattctatgatcagaaaagaagtc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35913936 |
cattagtcaaagctatgtggactcaaatcataatttgtggtaagatataaagacaaagctttgtgggttcaaaattctataatcagaaaagaagtc |
35914031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University