View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5637_low_14 (Length: 203)
Name: NF5637_low_14
Description: NF5637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5637_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 37342023 - 37342195
Alignment:
| Q |
16 |
caccttcctacaatggcacgtctagttttcttgatatgtttatttttcttcttacctacggtaatgtcatacgattttcttgtcctagctctacaatggc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37342023 |
caccttcctacaatggcacgtctagttttcttgatatgtttatttttcttcttacctacggtaatgtcatgcgattttcttgtcctagctctacaatggc |
37342122 |
T |
 |
| Q |
116 |
caataacctattgtaggtcaccatccaattgcaggacagggcttccacaaagtttaacaatacgcggtctgtg |
188 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37342123 |
caataacctattgtaggccaccatccaattgcaggacagggcttccacaaagtttaacaatacgcggtctgtg |
37342195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 135 - 180
Target Start/End: Complemental strand, 37334833 - 37334788
Alignment:
| Q |
135 |
accatccaattgcaggacagggcttccacaaagtttaacaatacgc |
180 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
37334833 |
accatccaattgcaggacatggcttccattaagtttaacaatacgc |
37334788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University