View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5637_low_4 (Length: 454)
Name: NF5637_low_4
Description: NF5637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5637_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 20 - 446
Target Start/End: Complemental strand, 194345 - 193927
Alignment:
| Q |
20 |
tgagcaacatcagaaacccatagaatgaaaggattattaatcaaacatgagacaggtggattttgttgggagattatggtagggaggacttgtttcccaa |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194345 |
tgagcaacatcagaaacccatggaatgaaaggattgttaatcaaacatgagacaggtggattttgttgggagattatggtagggaggacttgtttcccaa |
194246 |
T |
 |
| Q |
120 |
ccctctctagctgtggcaaatacacatccaagtcaagccgttttggttcattctcatcccaaccatcttcaaaccattcaaatctaataaatccttttcc |
219 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194245 |
ccatctctagttgtggcaaatacacatccaagtcaagccgttttggttcatcctcatcccaaccatcttcaaaccattcaaatctaataaatccttttcc |
194146 |
T |
 |
| Q |
220 |
tatcacaacttccttctcttcttctaaatctctagcttttctcatctctttgccccagcttttctggtgtgcaaaaagtcactgccaaaccttttgaggc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
194145 |
tatcacaacttccttctcttcttctaaatctctagcttttctcatctctttgccccagc-tttctagtgtgcaaaaagtcactgccaaaccttttgaggc |
194047 |
T |
 |
| Q |
320 |
caacagcttccccagcctcaatagagggttcacgtgtccttgcgccgggaacgatacaacatacaaggaacacatgctctacaatatcattatcacaccc |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194046 |
caacagcttccccagcctcaatagagggttcacgtgtccttgcgccgggaacg-------atacaaggaacacatgctctacaatatcattatcacaccc |
193954 |
T |
 |
| Q |
420 |
catttttcctttaatctcattcatctc |
446 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
193953 |
cattttccctttaatctcattcatctc |
193927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University