View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5637_low_9 (Length: 259)
Name: NF5637_low_9
Description: NF5637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5637_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 117 - 244
Target Start/End: Original strand, 42445248 - 42445374
Alignment:
| Q |
117 |
cttttcgttcatgtggatcttgatttgaattaagtttaaatttattgttgggttttgttcatatttgatgatgaactaagttcttcccttttttcccatt |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
42445248 |
ctttttgttcatgtggatcttgatttgaattaagtttaagtttattgttgggttttgttcatattcgatgatgaactaagttcttccc-tttttcccatt |
42445346 |
T |
 |
| Q |
217 |
gaaatctttcactgtttttggttggatt |
244 |
Q |
| |
|
||||||||||| | |||||| ||||||| |
|
|
| T |
42445347 |
gaaatctttcattatttttgattggatt |
42445374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 13 - 67
Target Start/End: Original strand, 42444853 - 42444907
Alignment:
| Q |
13 |
gagatgaaaaagaaatagtggttttgttacggaaaaattggggaccgagagagtg |
67 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444853 |
gagaagaaaaagaaatagtggttttgttacggaaaaattggggaccgagagagtg |
42444907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 95 - 198
Target Start/End: Original strand, 38659389 - 38659487
Alignment:
| Q |
95 |
tggatgataaattaagttcttccttttcgttcatgtggatcttgatttgaattaagtttaaatttattgttgggttttg-ttcatatttgatgatgaact |
193 |
Q |
| |
|
|||||||| |||||| ||||||||||| |||||||||||||| |||||||||| | |||||| |||||||||| ||||| || ||||||||||| |
|
|
| T |
38659389 |
tggatgatgaattaatttcttcctttttgttcatgtggatctgtatttgaattatg------tttattattgggttttgtttcatgttggatgatgaact |
38659482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 67
Target Start/End: Original strand, 38659297 - 38659351
Alignment:
| Q |
13 |
gagatgaaaaagaaatagtggttttgttacggaaaaattggggaccgagagagtg |
67 |
Q |
| |
|
|||| |||||||||| ||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
38659297 |
gagaagaaaaagaaaccgtggtggtgttagggaaaaattggggaccgagagagtg |
38659351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University