View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5639-Insertion-7 (Length: 360)
Name: NF5639-Insertion-7
Description: NF5639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5639-Insertion-7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 8 - 360
Target Start/End: Complemental strand, 43099555 - 43099199
Alignment:
| Q |
8 |
gttctagcatacactcgtctcgcaccttttcaccaaccaacacatagcaagaccatgttacgagtacaattcgaagttctcgattattttgtggataaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099555 |
gttctagcatacactcgtctcgcaccttttcaccaaccaacacatagcaagaccatgttacgagtacaattcgaagttctcgattattttgtggataaca |
43099456 |
T |
 |
| Q |
108 |
gggtatcttttggtattactgatggaagagtttgtggatttgtgcaatttggggtggtggtgaatactttgattaagatggatgggttgtttcatccgag |
207 |
Q |
| |
|
| |||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099455 |
gtgtatctttcggtattactgatggaagagttcgtggatttgtgcaatttggggtggtggtgaatactttgattaagatggatgggttgtttcatccgag |
43099356 |
T |
 |
| Q |
208 |
tgaatatcacttgaaggttacacgcaaacctttgaactttggaattccatcgtccaatattaacaacgttacttgggaattattgggtagtgtagcatgt |
307 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099355 |
tgaatatcgcttgaaggttacatgcaaacctttgaactttggaattccatcgtccaacattaacaacgttacttgggaattattgggtagtgtagcatgt |
43099256 |
T |
 |
| Q |
308 |
taatgatttaacaatggattag----ggagtgtgcatgttcaatgttttaatttgtg |
360 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43099255 |
taatgatttaacaatggattaggggtggagtgtgcatgttcaatgttttaatttgtg |
43099199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University