View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5639_low_12 (Length: 250)
Name: NF5639_low_12
Description: NF5639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5639_low_12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 38 - 250
Target Start/End: Original strand, 22364530 - 22364759
Alignment:
| Q |
38 |
ccttcataagtttgtttaaatacacataagtttcaagattttcacaattcaaacaaactcttaactatgaataagaggttt-----------------ca |
120 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
| T |
22364530 |
ccttcataagtttgtttagatacacataagtttcaagattttcacaattcaaacaaactcttaactatgaattagaggtttgatagatggtttcatttca |
22364629 |
T |
 |
| Q |
121 |
attatcatcatcataaacataaactcttacacaatgaaatgtatagacccaatacacaatgttggcaacaaatttaatgcatagactccaaataataatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22364630 |
attatcatcatcataaacataaactcttacacaatgaaatgtatagacccaatacacaatgttggcaacaaatttaatgaatagactccaaataataatt |
22364729 |
T |
 |
| Q |
221 |
taatttcaaacaattgtgagcaaaagatta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22364730 |
taatttcaaacaattgtgagcaaaagatta |
22364759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University