View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5639_low_7 (Length: 364)
Name: NF5639_low_7
Description: NF5639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5639_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 322; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 18 - 347
Target Start/End: Complemental strand, 43099880 - 43099551
Alignment:
| Q |
18 |
attctatcaagcaccagcaaccaccttcacatatgaagaagaacccccggctgttgtaagatccttcctctgcggcttcatctctgtcatgacggccatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43099880 |
attctatcaagcaccagcaaccaccttcacatatgaagaagaacccccggctgttgtaagatccttcctctgcggcttcatctctgtcatgaccgccatc |
43099781 |
T |
 |
| Q |
118 |
gtagctctcttcggcttaatctccttgatcggctattttgttctcaaaccccgtatccctgagttcagtgtcaattcagcttcacttacctcattcaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099780 |
gtagctctcttcggcttaatctccttgatcggctattttgttctcaaaccccgtatccctgagttcagtgtcaattcagcttcacttacctcattcaatt |
43099681 |
T |
 |
| Q |
218 |
tgaccggctccggtctcaatgcaaaatgggacatcacactcattgtctcaaaccctaacaaaaaactcgatatcacatacgacgccgttgctgccagtgt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099680 |
tgaccggctccggtctcaatgcaaaatgggacatcacactcattgtctcaaaccctaacaaaaaactcgatatcacatacgacgccgttgctgccagtgt |
43099581 |
T |
 |
| Q |
318 |
cttttacggagatgatgaatatggtgttct |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
43099580 |
cttttacggtgatgatgaatatggtgttct |
43099551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 232 - 326
Target Start/End: Complemental strand, 43106880 - 43106786
Alignment:
| Q |
232 |
ctcaatgcaaaatgggacatcacactcattgtctcaaaccctaacaaaaaactcgatatcacatacgacgccgttgctgccagtgtcttttacgg |
326 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||| ||| |||||||| ||| ||||||||||||| |
|
|
| T |
43106880 |
ctcactgcaaaatgggacatcacattcattgcctcaaaccctaacaaaaaactcgacatcacctacaacgccgtttctgttggtgtcttttacgg |
43106786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University