View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5640_high_4 (Length: 291)
Name: NF5640_high_4
Description: NF5640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5640_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 17 - 273
Target Start/End: Original strand, 7292975 - 7293231
Alignment:
| Q |
17 |
atgaatcaaacaagggcatctgatgagttaatttttgtgagccaaatttttaaccagatgcattgatttttcaaccaccgctttaatttgtttatatttt |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7292975 |
atgaatcaaacaagggcacctgatgagttaatttttgtgagccaaatttttaaccagatgcattgatttttcaaccaccgctttaatttgtttatatttt |
7293074 |
T |
 |
| Q |
117 |
atttcggaagaagtattttataagattctacgtatatttgtgtgtacaatcaaatggaaaatgacaatatgaaaattatgcataagccaaaaacaactta |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7293075 |
atttcagaagaagtattttataagattctacgtatatttgtgtgtacaatcaaatggaaaatgacaatatgaaaattatgcataagcgaaaaacaactta |
7293174 |
T |
 |
| Q |
217 |
ggacaataatttatatctagaagtgttgataaaaaacgattgaggggaaactctaca |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7293175 |
ggacaataatttatatctagaagtgttgataaaaaacgattgaggggaaactctaca |
7293231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University