View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5640_low_15 (Length: 201)
Name: NF5640_low_15
Description: NF5640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5640_low_15 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 32377666 - 32377855
Alignment:
| Q |
1 |
cagttactactatcgttatctcttactttgtgtagaattgcggtaaccttgattgcgattatgttgtggttgtgaagacatgaaaattataatgttgtgt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32377666 |
cagttactactatcgtgatctcttactttgtgtagaattg-----------attgcgattatgttgtggttgcgaagacatgaaaattataatgttgtgt |
32377754 |
T |
|
| Q |
101 |
aacttttttgttttgtttatgtctttcacatatgcatgttcttgatgtgtaacaaaaatggtagttcatagagtgggagagagagaagaataggaagcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377755 |
aacttttttgttttgtttatgtctttcacatatgcatgttcttgatgtgtaacaaaaatggtagttcatagagtgggagagagagaagaataggaagcac |
32377854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University