View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5640_low_3 (Length: 396)
Name: NF5640_low_3
Description: NF5640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5640_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 9 - 247
Target Start/End: Original strand, 32377241 - 32377479
Alignment:
| Q |
9 |
acatcatcactttgaatgacatcaaggaaaggagtaaggtaaatggaaggatcgatagtgcgccattcttgttgaggattgaatatgagagaacggagag |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377241 |
acatcatcgctttgaatgacatcaaggaaaggagtaaggtaaatggaaggatcgatagtgcgccattcttgttgaggattgaatatgagagaacggagag |
32377340 |
T |
|
| Q |
109 |
accttaaagaattaataatggaagaatcgtaggattcttcaggagaagatatgttgtagacaggagtaaattcgggataacgtcgtatcactgctagaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377341 |
accttaaagaattaataatggaagaatcgtaggattcttcaggagaagatatgttgtagacaggagtaaattcgggataacgtcgtatcactgctagaac |
32377440 |
T |
|
| Q |
209 |
tgcaccaacttcagtgcttaacatgcatgagagtcctag |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377441 |
tgcaccaacttcagtgcttaacatgcatgagagtcctag |
32377479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 287 - 396
Target Start/End: Original strand, 32377519 - 32377628
Alignment:
| Q |
287 |
attacgaacatcttctagttcttcgtgtgtgaaatcttctatgctatccattgcatgcatgacgatgtaaaattaatattcctaggaacaacatggttac |
386 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |||||||| |
|
|
| T |
32377519 |
attacgatcatcttctagttcttcgtgtgtgaaatcttctatgctatccattgcatgcatgaagatgtaaaattaatattcctaggaaaaatatggttac |
32377618 |
T |
|
| Q |
387 |
gtggttaatt |
396 |
Q |
| |
|
|| ||||||| |
|
|
| T |
32377619 |
gtagttaatt |
32377628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University