View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5640_low_7 (Length: 253)
Name: NF5640_low_7
Description: NF5640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5640_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 39 - 245
Target Start/End: Complemental strand, 27680564 - 27680359
Alignment:
| Q |
39 |
gtcaaaaaactaatattccttgtaaaaaatttgaaattcatattacatnnnnnnnnnnnnnnnnttgaaatttaagtgagtagtt-aatttatttattcc |
137 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27680564 |
gtcaaaaaattaatattccttgtaaaaaatttgaaattcatattacataaaaaaaaaaaaaa--ttgaaatttaagtgagtagtttaatttatttattcc |
27680467 |
T |
|
| Q |
138 |
actactgttggtactggtgaccacaactattttctatttggaaaacatgacctgtcagaatcttgtcatacttggtggaggcaatctttgtttagacata |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27680466 |
actactgttggtactggtgaccacaactattttctatttggaaaacatgacctgtcagaatcttgtcatacttggtggaggcaatctttgtttagacata |
27680367 |
T |
|
| Q |
238 |
tattcttc |
245 |
Q |
| |
|
| |||||| |
|
|
| T |
27680366 |
ttttcttc |
27680359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University