View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5640_low_8 (Length: 251)
Name: NF5640_low_8
Description: NF5640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5640_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 248
Target Start/End: Original strand, 13726170 - 13726404
Alignment:
| Q |
14 |
agacaacacaatcaacagggttgtttgaactttgaagtttatgaagaagctgagaaagtgattttggtccaactttccagaaagtgtctttgtaagattc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13726170 |
agacaacacaatcaacagggttgtttgaactttgaagtttatgaagaagctgagaaagtgattttggtccaactttccagaaagtgtctttgtaagattc |
13726269 |
T |
|
| Q |
114 |
catattttctgctgatgacattcctccattgtcataaccatctgaaatgctttcagtttgaattgaatttagatcaatgttgttgttgattttgttccaa |
213 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13726270 |
catgttttctgctgatgacattcctccattgtcataaccatctgaaatgctttcagtttcaattgaattgagatcaatgttgttgttgattttgttccaa |
13726369 |
T |
|
| Q |
214 |
atggaaatggtgttcactagtgtgatttttactcc |
248 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13726370 |
atggaaatggtgttcactagtgttatttttactcc |
13726404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University