View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5642_high_4 (Length: 239)
Name: NF5642_high_4
Description: NF5642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5642_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 48894935 - 48894727
Alignment:
| Q |
12 |
ataggagtaatgtttgtgcggccaaaacggcccgtgattaattcaccatgcctcttgataaagaaaggcgtacatacatacatacatacgcaagacctta |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
48894935 |
ataggagtaatgtttgtgcggccaaaacggcccgtgattaattcaccatgcctcttgataaagaaaggcgtacatacatacatac----gccagacctta |
48894840 |
T |
 |
| Q |
112 |
attgacattactttccaaccatttctgtttcagcttgcagaaattgttgtgtcaacaacagtaaccacatgatgaagcttcgatttattgctgtggttgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48894839 |
attgacattactttccaaccatttctgtttcagcttgcagaaattgttgtgtcaacaacagtaaccacatgatgaagcttcgatttatggctgtggttgt |
48894740 |
T |
 |
| Q |
212 |
tatgctgttaagt |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48894739 |
tatgctgttaagt |
48894727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University