View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5644-Insertion-10 (Length: 219)
Name: NF5644-Insertion-10
Description: NF5644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5644-Insertion-10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 121 - 216
Target Start/End: Complemental strand, 47036954 - 47036859
Alignment:
| Q |
121 |
atgaaaaagaatcaggagcacaattacagagtcatgtcggtattatatttatgataaatgcagttatgtttatcggttgtcatgtgaatgctctct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036954 |
atgaaaaagaatcaggagcacaattacagagtcatgtcggtattatatttatgataaatgcagttatgtttatcggttgtcatgtgaatgctctct |
47036859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 47037068 - 47037019
Alignment:
| Q |
8 |
ttttggagcttaccattccatttgttttttatgagtagggaccatcaaga |
57 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47037068 |
ttttggagcttaccataccatttgttttttatgagtagggaccatcaaga |
47037019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University