View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5644-Insertion-8 (Length: 381)
Name: NF5644-Insertion-8
Description: NF5644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5644-Insertion-8 |
 | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 267 - 361
Target Start/End: Original strand, 42339757 - 42339852
Alignment:
| Q |
267 |
gtatgtatattttggcctcattattaacaaggaagttatgggtgtttggtttt-gtaggtgttccgtatatatgcggcgccggttgtttgcatttt |
361 |
Q |
| |
|
|||||||||||||| ||||||||||| | |||| | || ||||| |||||||| |||||||||||||||||||| ||| ||| ||| ||| ||||| |
|
|
| T |
42339757 |
gtatgtatattttgtcctcattattatctaggaggataggggtgcttggtttttgtaggtgttccgtatatatgtggcaccgtttgcttgtatttt |
42339852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 320 - 352
Target Start/End: Original strand, 26042306 - 26042338
Alignment:
| Q |
320 |
gtaggtgttccgtatatatgcggcgccggttgt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26042306 |
gtaggtgttccgtatatatgcggcgccggttgt |
26042338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 307 - 346
Target Start/End: Original strand, 60148 - 60187
Alignment:
| Q |
307 |
ggtgtttggttttgtaggtgttccgtatatatgcggcgcc |
346 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
60148 |
ggtgtttgtttttggaggtgttccgtatatatgcggcgcc |
60187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University