View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5644_high_4 (Length: 377)
Name: NF5644_high_4
Description: NF5644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5644_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 4e-54; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 18 - 125
Target Start/End: Complemental strand, 14570854 - 14570747
Alignment:
| Q |
18 |
gttgttgtataggtgatatttgttgtaggtaattgcggtagttatgtgttgcaggttatgagttatttatgaatacttacatgtgaaacagtaaaacaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14570854 |
gttgttgtataggtgatatttgttgtaggtaattgcggtagttatgtgttgcaggttatgagttatttatgaatacttacatgtgaaacagtaaaacaca |
14570755 |
T |
|
| Q |
118 |
gatgtacg |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
14570754 |
gatgtacg |
14570747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 14570670 - 14570625
Alignment:
| Q |
202 |
tttgtttgtacatagttcgtaagatttgattgagtattttttaatg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14570670 |
tttgtttgtacatagttcgtaagatttgattgagtattttttaatg |
14570625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 324 - 363
Target Start/End: Complemental strand, 14570548 - 14570509
Alignment:
| Q |
324 |
atgtttgcagatataagtagtgattttgataggtaaaaga |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14570548 |
atgtttgcagatataagtagtgattttgataggtaaaaga |
14570509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 20 - 125
Target Start/End: Complemental strand, 19782839 - 19782734
Alignment:
| Q |
20 |
tgttgtataggtgatatttgttgtaggtaattgcggtagttatgtgttgcaggttatgagttatttatgaatacttacatgtgaaacagtaaaacacaga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19782839 |
tgttgtataggtgatatttgttgtaggtaattgtagtagttatgtgttgcaggttatgagctatttatgaatacttacatgcgaaacagtaaaacacaga |
19782740 |
T |
|
| Q |
120 |
tgtacg |
125 |
Q |
| |
|
|||||| |
|
|
| T |
19782739 |
tgtacg |
19782734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 19782657 - 19782612
Alignment:
| Q |
202 |
tttgtttgtacatagttcgtaagatttgattgagtattttttaatg |
247 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19782657 |
tttgtttgtacatagttcgtaagaattgattgagtattttttaatg |
19782612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 360
Target Start/End: Complemental strand, 19782535 - 19782499
Alignment:
| Q |
324 |
atgtttgcagatataagtagtgattttgataggtaaa |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19782535 |
atgtttgcagatataagtagtgattttgatagataaa |
19782499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University