View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5644_low_12 (Length: 285)
Name: NF5644_low_12
Description: NF5644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5644_low_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 5170790 - 5170502
Alignment:
| Q |
1 |
aatttaaataaacatcatcattctatttcgaaccaacgatcaagggtgtgacgactatgtgaatgcgttgaattttttaatgcagtcaacccgatttcaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
5170790 |
aatttaaataaacatcaccattctatttcgaatcaacgatcaaggatgtgacgactatgtgaatgcctcgaattttttaatgcagttaacccgatttcaa |
5170691 |
T |
 |
| Q |
101 |
attcagagtctttttgccatgttgccacttcttgatagtagctcatcatgacagcctttggtt----tttcatttcactttcatccattaaatgttgctc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5170690 |
attcagagtctttttgccatgttgccacttcttgatagtagcccatcatgacagcctttggttttgctttcatttcactttcatccattaaatgttgctc |
5170591 |
T |
 |
| Q |
197 |
caactctaacaacctctttacttccatatgttacagatatgtactatcaacataaagtatgaactcagataataacattgttgaaactt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5170590 |
caactctaacaacctctttacttccatatgttacaaacatgtactatcaacataaagtatgaactcagataataacattgttgaaactt |
5170502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University