View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5644_low_14 (Length: 257)
Name: NF5644_low_14
Description: NF5644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5644_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 21 - 253
Target Start/End: Original strand, 27696999 - 27697220
Alignment:
| Q |
21 |
ctcatataggcgagtcgttgtaactatcctcgttgtattcgacatgagatgcaaaagacggttgtatgatgatccaacggtccagagaagaggtgatgca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27696999 |
ctcatataggcgagtcgttgtaactatcctcgttgtattcgacatgagatgcaaaagacagttgtatgatgatccaacggtccagagcagaggtgatgca |
27697098 |
T |
|
| Q |
121 |
ctcttgtgtggtgaggcacattggacgtcttctggtcttgcaggttcaacaaacccttgagaaattaagcacattggaacccttgcaggttccaaaatct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27697099 |
ctcttgtgtggtgaggcacattggacgtcttctggtcttgcaggttcaacaaacccttgagaaattaagcacattgga--------aggttccaaaa--- |
27697187 |
T |
|
| Q |
221 |
tcttactaattattttgaatttagaattatcta |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27697188 |
tcttactaattattttgaatttagaattatcta |
27697220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University