View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5644_low_3 (Length: 379)
Name: NF5644_low_3
Description: NF5644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5644_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 153 - 370
Target Start/End: Complemental strand, 6330251 - 6330034
Alignment:
| Q |
153 |
atcaacacaggaagtgaagctaacattctctacatgtcagcattcttgaaaatgaggctatcagagtcaatgctgcaaccgtgtgatgcatttctgaaag |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6330251 |
atcaacacaggaagtgaagctaacattctctacatgtcagcattcttgaaaatgaggctatcagagtcaatgctgcaaccgtgtgatgcatttctgaaag |
6330152 |
T |
|
| Q |
253 |
atgttcttggaaaaggtgggaatgccaagatgatcaaggtgaggtacttggtcgttgattcacactctatttataatgttgttattggtatgcctactct |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6330151 |
atgttcttggaaaaggtgggaatgccaagatgatcaaggtgaggtacttggtcgttgattcacactctatttataatgttgttattggtatgcctactct |
6330052 |
T |
|
| Q |
353 |
tagtgatttgagaataat |
370 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
6330051 |
tagtgatttgagagtaat |
6330034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 21 - 159
Target Start/End: Complemental strand, 6330410 - 6330275
Alignment:
| Q |
21 |
agttcaacaagaaacgatgatgatggtagtgacattattgaaccagaaaacatgccaatatcgttttcaaacaaagactatgcattattcaaaggaacta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
6330410 |
agttcaacaagaaacgatgatgatggtagtgacattattgaaccagaaaacatgccaatatcgttttcaaccaaagactatgc---attcaaaggaacta |
6330314 |
T |
|
| Q |
121 |
gtgctcctcttcctatggtcatcaaactccaaatcaaca |
159 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
6330313 |
gtgctcttcttcctatggtcatcaaacaccaaatcaaca |
6330275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 159
Target Start/End: Complemental strand, 6318133 - 6318101
Alignment:
| Q |
127 |
ctcttcctatggtcatcaaactccaaatcaaca |
159 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
6318133 |
ctcttcctatggtaatcaaactccaaatcaaca |
6318101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 159
Target Start/End: Complemental strand, 6327375 - 6327343
Alignment:
| Q |
127 |
ctcttcctatggtcatcaaactccaaatcaaca |
159 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
6327375 |
ctcttcctatggtaatcaaactccaaatcaaca |
6327343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University