View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5645_high_4 (Length: 383)
Name: NF5645_high_4
Description: NF5645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5645_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 346
Target Start/End: Complemental strand, 50454469 - 50454124
Alignment:
| Q |
1 |
ttagaccatccccttgttttgttgctacnnnnnnnntcaccgttattgatgtttttaattttgatttctcgtattttaggtttgtcggctaaaacagaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50454469 |
ttagaccatccccttgttttgttgctacaaaaaaattcaccgttattgatgtttttaattttgatttctcgtattttaggtttgtcagctaaaacagaca |
50454370 |
T |
|
| Q |
101 |
ctaccgaagttggataaaaactatgctgctcaatcagagaaagacacgggtaaattttctattaccattctgttctgctagcttttggataattttattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50454369 |
ctaccgaagttggataaaaactatgctgctcaatcagagaaagacacgggtaaattttctattaccattctgttctgctagtttttggataattttattc |
50454270 |
T |
|
| Q |
201 |
tatttcaggttaaattgagaagacagatatatttgtataaggaaaaggaaaatagttatacagggattcgttgaagtgtgtgcttgtgcatctgctctca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50454269 |
tatttcaggttaaattgagaagacagatatatttgtataaggaaaaggaaaatagttatacagggattcgttgaagtgtgtgcttgtgcatctgctctca |
50454170 |
T |
|
| Q |
301 |
gattggtgcctttagctgtattctgtatacatgcacaatgatgatg |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50454169 |
gattggtgcctttagctgtattctgtatacatgcacaatgatgatg |
50454124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University